Skip to content

ssmswapnil/quantum_genetic_encoding

Repository files navigation

🧬 Quantum Encoding of Genetic Information

PhysisTechne Symposium 2026 — Quantum Computing Track
Encoding DNA sequences into quantum circuits using three encoding strategies,
benchmarked on IBM's FakeSherbrooke 127-qubit Eagle processor

Qiskit Python Backend License


Overview

This project implements a complete pipeline for encoding DNA sequences into optimized quantum circuits. DNA is divided into codons (triplets), their frequencies are computed, and the resulting weight distribution is encoded into quantum states using three different strategies — each with different qubit, gate, and fidelity tradeoffs.

Two pipelines are provided:

Pipeline Entry Point Encodings Target Sequence
Pipeline 1 main.py Amplitude + Angle 50-base sequence
Pipeline 2 main_aae.py Approximate Amplitude (AAE) 12,001-base Rhesus macaque chr16

Pipeline Architecture

High-Level Flow

flowchart LR
    A[🧬 DNA Sequence] --> B[Step 1: Codon Division]
    B --> C[Classical Bit Register]
    C --> D[Step 2: Quantum Encoding]
    D --> E[Step 3: Simulation]
    E --> F[Aer - Ideal]
    E --> G[FakeSherbrooke - Noisy]
    F --> H[Fidelity Comparison]
    G --> H
    H --> I[📊 Results]
Loading

Step 1 — Classical Bit Register

flowchart TD
    A["ATGCGTACG...TTAGC (50 bases)"] --> B["Divide into codons (size 3)"]
    B --> C["['ATG', 'CGT', 'ACG', 'TTA', ...]"]
    C --> D["Count frequencies (weights)"]
    D --> E["CGT: 3, ACG: 2, TTA: 2, GAT: 2, ..."]
    E --> F["Unique Register (12 entries)\nindex → codon → weight"]
    E --> G["Position Register (17 entries)\nposition → codon → index"]
Loading

Step 2 — Three Encoding Strategies

flowchart TD
    subgraph AMP["Amplitude Encoding"]
        A1["Weights → amplitudes of basis states"]
        A2["|ψ⟩ = (1/N) Σᵢ wᵢ|i⟩"]
        A3["4 qubits | 8 CNOT + 8 Ry = 16 gates"]
    end
    
    subgraph ANG["Angle Encoding"]
        B1["Each codon → own qubit with Ry rotation"]
        B2["|ψ⟩ = ⊗ᵢ Ry(θᵢ)|0⟩"]
        B3["12 qubits | 12 Ry + 0 CNOT | depth 1"]
    end
    
    subgraph AAE["Approximate Amplitude Encoding"]
        C1["Train shallow PQC variationally"]
        C2["Brickwall ansatz + L-BFGS optimizer"]
        C3["7 qubits | 42 Ry + 18 CNOT | depth 12"]
    end
Loading

Step 3 — Dual Backend Simulation

flowchart LR
    A[Encoded Circuit] --> B[Transpile for Sherbrooke]
    B --> C["Aer Simulator\n(ideal, no noise)"]
    B --> D["FakeSherbrooke\n(127-qubit Eagle noise)"]
    C --> E["Density Matrix\n(exact statevector)"]
    D --> F["Density Matrix\n(noisy simulation)"]
    E --> G["State Fidelity\nF(ρ_ideal, ρ_noisy)"]
    F --> G
Loading

Encoding Strategies

Amplitude Encoding

Encodes codon weights as amplitudes of computational basis states. Uses initialize() which decomposes into 2^(n-1) CNOT gates and 2^(n-1) Ry rotation gates.

|ψ⟩ = (1/N)(w₀|0000⟩ + w₁|0001⟩ + w₂|0010⟩ + ...)
Property Value
Qubits ceil(log₂(N_unique))
CNOT gates 2^(n-1)
Ry gates 2^(n-1)
Encoding Exact
Entanglement Yes

Angle Encoding

Encodes each codon weight as an Ry rotation angle on its own dedicated qubit. Weights are rescaled to (0, 2π] to prevent information loss.

|ψ⟩ = Ry(θ₀)|0⟩ ⊗ Ry(θ₁)|0⟩ ⊗ ... ⊗ Ry(θₙ)|0⟩
Property Value
Qubits N_unique (one per codon)
CNOT gates 0
Ry gates N_unique
Depth 1
Entanglement None (product state)

Approximate Amplitude Encoding (AAE)

Trains a shallow parameterized quantum circuit (brickwall ansatz) to approximate the target amplitude distribution using variational optimization.

U(θ)|0⟩ ≈ |target⟩     minimizing C(θ) = 1 - Re⟨target|U(θ)|0⟩
Property Value
Ansatz Brickwall (alternating CNOT pairs)
Optimizer L-BFGS (quasi-Newton)
Training Statevector simulation (exact)
Depth O(poly(log N))
Scalable Yes

Brickwall Ansatz Structure:

Layer 1:  ─Ry─╥─Ry─╥─Ry─╥─Ry─╥─Ry─╥─Ry─╥─Ry─
               ║    ║    ║    ║    ║    ║    ║
          ─────╨────╨────╨────╨────╨────╨────╨──
          CNOT: (0,1)  (2,3)  (4,5)          [even pairs]

Layer 2:  ─Ry──Ry──Ry──Ry──Ry──Ry──Ry─
          CNOT:   (1,2)  (3,4)  (5,6)        [odd pairs]

Results

Pipeline 1 — Amplitude vs Angle Encoding (50 bases)

Metric Amplitude Angle
Qubits 4 12
Logical CNOT gates 8 0
Logical Ry gates 8 12
Total logical gates 16 12
Transpiled depth 67 5
Two-qubit gates (transpiled) 15 0
F(initial, Aer) 1.000 1.000
F(initial, Sherbrooke) 0.959 0.985
Noise drop 0.041 0.015
Reconstruction 100% 100%

Angle encoding achieves higher fidelity (0.985 vs 0.959) due to zero two-qubit gates and depth 1, but requires 3× more qubits.

Pipeline 2 — AAE on 12,001-Base Sequence

Metric Value
Sequence length 12,001 bases
Total codons 4,001
Unique codons 65
Qubits 7
Ansatz layers 6
Trainable parameters 42
Logical gates 60 (42 Ry + 18 CNOT)
Transpiled depth 39
Two-qubit gates (transpiled) 18
Overlap O 0.973
F(trained, aer) 1.000
F(target, trained) 0.947
F(target, aer) 0.947
F(trained, Sherbrooke) 0.941
F(target, Sherbrooke) 0.890
Noise drop 0.060
Reconstruction 100%
Runtime 362s

12,001 bases encoded into a 7-qubit, depth-39 circuit with 89% end-to-end fidelity on a noisy 127-qubit backend.

Fidelity Breakdown (AAE)

flowchart LR
    A["Target |Data⟩"] -- "F = 0.947\n(training quality)" --> B["Trained U(θ)|0⟩"]
    B -- "F = 1.000\n(ideal)" --> C["Aer Output"]
    B -- "F = 0.941\n(noise impact)" --> D["Sherbrooke Output"]
    A -- "F = 0.890\n(end-to-end)" --> D
Loading

Project Structure

├── main.py                    # Pipeline 1: Amplitude + Angle encoding (50 bases)
├── main_aae.py                # Pipeline 2: AAE encoding (12,001 bases)
├── requirements.txt
├── LICENSE
│
├── src/                       # Pipeline 1 modules
│   ├── compression.py         #   Step 1: Codon division + classical register
│   ├── encoding.py            #   Step 2: Amplitude & angle encoding
│   ├── simulation.py          #   Step 3: Aer + FakeSherbrooke simulation
│   ├── reconstruction.py      #   DNA reconstruction via classical register
│   └── fidelity.py            #   Fidelity calculations
│
├── src2/                      # Pipeline 2 modules (AAE)
│   ├── compression2.py        #   Step 1: Codon division + target distributions
│   ├── aae_encoding.py        #   Step 2: Brickwall ansatz + L-BFGS training
│   ├── simulation2.py         #   Step 3: Dual backend simulation
│   ├── reconstruction2.py     #   DNA reconstruction
│   └── fidelity2.py           #   Fidelity (target vs trained vs noisy)
│
├── data/
│   └── dna_12000.txt          # 12,001-base Rhesus macaque chr16 fragment
│
└── results/
    ├── summary.json            # Pipeline 1 output
    └── summary_aae.json        # Pipeline 2 output

Quick Start

# Clone and setup
git clone https://github.com/YOUR_USERNAME/quantum-dna-encoding.git
cd quantum-dna-encoding
python -m venv venv
venv\Scripts\activate           # Windows
pip install -r requirements.txt

# Run Pipeline 1: Amplitude + Angle encoding (50 bases)
python main.py

# Run Pipeline 2: AAE encoding (12,001 bases)
python main_aae.py

DNA Sequences

Pipeline 1 (50 bases):

ATGCGTACGTTAGCGTACGATCGTAGCTAGCTTGACGATCGTACGTTAGC

Pipeline 2 (12,001 bases): Rhesus macaque (Macaca mulatta) chromosome 16 fragment — NC_133421.1:91056922-91068922, gene LOC144335571


References

  1. IBM Quantum Learning — Data Encoding
  2. IBM Qiskit — FakeSherbrooke Backend
  3. Schuld, M., & Petruccione, F. (2021). Machine learning with quantum computers (2nd ed.). Springer.
  4. Wright, L., Mc Keever, C., First, J. T., Johnston, R., Tillay, J., Chaney, S., Rosenkranz, M., & Lubasch, M. (2024). Noisy intermediate-scale quantum simulation of the one-dimensional wave equation. arXiv.
  5. Riera Aroche, R., Ortiz García, Y. M., Martínez Arellano, M. A., & Riera Leal, A. (2024). DNA as a perfect quantum computer based on the quantum physics principles. Scientific Reports, 14(1), 11636.
  6. Lu, W., Onuchic, J. N., & Di Pierro, M. (2023). An associative memory Hamiltonian model for DNA and nucleosomes. PLoS Computational Biology, 19(3), e1011013.

License

MIT

About

Quantum encoding of DNA sequences using amplitude and angle encoding on IBM's FakeSherbrooke (127-qubit Eagle) backend. Built for PhysisTechne Symposium 2026.

Resources

License

Stars

0 stars

Watchers

0 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors