Completed mp1 part2

gene_finder.py

@@ -2,7 +2,7 @@
 """
 YOUR HEADER COMMENT HERE
 
-@author: YOUR NAME HERE
+@author: Felix Eberhardt
 
 """
 
@@ -20,7 +20,7 @@ def shuffle_string(s):
 # YOU WILL START YOUR IMPLEMENTATION FROM HERE DOWN ###
 
 
-def get_complement(nucleotide):
+def get_complement(nucleotide): #week1
     """ Returns the complementary nucleotide
 
         nucleotide: a nucleotide (A, C, G, or T) represented as a string
@@ -30,11 +30,17 @@ def get_complement(nucleotide):
     >>> get_complement('C')
     'G'
     """
-    # TODO: implement this
-    pass
+    if nucleotide == 'A':
+        return 'T'
+    elif nucleotide == 'C':
+        return 'G'
+    elif nucleotide == 'T':
+        return 'A'
+    elif nucleotide == 'G':
+        return 'C'
 
 
-def get_reverse_complement(dna):
+def get_reverse_complement(dna): #week1
     """ Computes the reverse complementary sequence of DNA for the specfied DNA
         sequence
 
@@ -45,11 +51,25 @@ def get_reverse_complement(dna):
     >>> get_reverse_complement("CCGCGTTCA")
     'TGAACGCGG'
     """
-    # TODO: implement this
-    pass
-
-
-def rest_of_ORF(dna):
+    # Step 1 get complement
+    counter_1=0
+    complement_dna = ''
+    while counter_1 < len(dna):
+        complement_dna = complement_dna + get_complement(dna[counter_1])
+        counter_1 = counter_1 + 1
+    # Step 2 reverse it
+    reverse_complement = ''
+    counter_2=len(dna)-1
+    while counter_2 >= 0:
+        reverse_complement = reverse_complement + complement_dna[counter_2]
+        counter_2 = counter_2 - 1
+    return reverse_complement
+
+# Define Stop Codons
+stop_codons = ['TAA', 'TAG', 'TGA']
+start_codon = 'ATG'
+
+def rest_of_ORF(dna): #week1
     """ Takes a DNA sequence that is assumed to begin with a start
         codon and returns the sequence up to but not including the
         first in frame stop codon.  If there is no in frame stop codon,
@@ -62,11 +82,13 @@ def rest_of_ORF(dna):
     >>> rest_of_ORF("ATGAGATAGG")
     'ATGAGA'
     """
-    # TODO: implement this
-    pass
-
+    i=0
+    for i in range(0,len(dna), 3):
+        if dna[i:i+3] in stop_codons:
+            return dna[:i]
+    return dna
 
-def find_all_ORFs_oneframe(dna):
+def find_all_ORFs_oneframe(dna): #week1
     """ Finds all non-nested open reading frames in the given DNA
         sequence and returns them as a list.  This function should
         only find ORFs that are in the default frame of the sequence
@@ -79,11 +101,19 @@ def find_all_ORFs_oneframe(dna):
     >>> find_all_ORFs_oneframe("ATGCATGAATGTAGATAGATGTGCCC")
     ['ATGCATGAATGTAGA', 'ATGTGCCC']
     """
-    # TODO: implement this
-    pass
 
-
-def find_all_ORFs(dna):
+    count=0
+    all_ORFs_oneframe = [] #empty list
+    while count < len(dna):
+        if dna[count:count+3] == start_codon:
+            orf = rest_of_ORF(dna[count:])
+            all_ORFs_oneframe.append(orf)
+            count = count + len(orf)
+        else :
+            count = count + 3
+    return all_ORFs_oneframe
+
+def find_all_ORFs(dna): #week1
     """ Finds all non-nested open reading frames in the given DNA sequence in
         all 3 possible frames and returns them as a list.  By non-nested we
         mean that if an ORF occurs entirely within another ORF and they are
@@ -96,11 +126,10 @@ def find_all_ORFs(dna):
     >>> find_all_ORFs("ATGCATGAATGTAG")
     ['ATGCATGAATGTAG', 'ATGAATGTAG', 'ATG']
     """
-    # TODO: implement this
-    pass
-
+    all_ORFs = find_all_ORFs_oneframe(dna) + find_all_ORFs_oneframe(dna[1:]) + find_all_ORFs_oneframe(dna[2:])
+    return all_ORFs
 
-def find_all_ORFs_both_strands(dna):
+def find_all_ORFs_both_strands(dna): #week1
     """ Finds all non-nested open reading frames in the given DNA sequence on both
         strands.
 
@@ -109,19 +138,22 @@ def find_all_ORFs_both_strands(dna):
     >>> find_all_ORFs_both_strands("ATGCGAATGTAGCATCAAA")
     ['ATGCGAATG', 'ATGCTACATTCGCAT']
     """
-    # TODO: implement this
-    pass
+#   create empty lists
+    all_ORFs_both_strands = []
+#   search in them and add lists together
+    all_ORFs_both_strands = find_all_ORFs(dna) + find_all_ORFs(get_reverse_complement(dna))
+    return all_ORFs_both_strands
 
+    ##### week 2 ######
 
 def longest_ORF(dna):
     """ Finds the longest ORF on both strands of the specified DNA and returns it
         as a string
     >>> longest_ORF("ATGCGAATGTAGCATCAAA")
     'ATGCTACATTCGCAT'
     """
-    # TODO: implement this
-    pass
-
+    longest_ORF = max(find_all_ORFs_both_strands(dna), key=len)
+    return longest_ORF
 
 def longest_ORF_noncoding(dna, num_trials):
     """ Computes the maximum length of the longest ORF over num_trials shuffles
@@ -130,8 +162,18 @@ def longest_ORF_noncoding(dna, num_trials):
         dna: a DNA sequence
         num_trials: the number of random shuffles
         returns: the maximum length longest ORF """
-    # TODO: implement this
-    pass
+
+    t=0
+    ORF_noncoding = []
+    while t < num_trials:        # loop it for num_trials times
+        a = shuffle_string(dna) # use shuffling function to create new dna
+        b = longest_ORF(a)      # put it in longest_ORF
+        ORF_noncoding.append(b) # return len as integer to list
+        t = t + 1
+    longest_ORF_noncoding = max(ORF_noncoding, key=len)# Look for and return the longest ORF (same function as used above)
+    max_length = len(longest_ORF_noncoding)
+    return max_length
+
 
 
 def coding_strand_to_AA(dna):
@@ -148,8 +190,14 @@ def coding_strand_to_AA(dna):
         >>> coding_strand_to_AA("ATGCCCGCTTT")
         'MPA'
     """
-    # TODO: implement this
-    pass
+
+    strand_to_AA = '' # empty string to append
+    for n in range(0, len(dna), 3): #go through dna string
+        for i in range(0, len(codons)): #go through inner lists
+            if dna[n:n+3] in codons[i]: #search for dna in each inn
+                amino =  aa[i]   # convert each triplet into the linked letter
+                strand_to_AA += amino # append it to the amino string
+    return strand_to_AA #return the string of aminos
 
 
 def gene_finder(dna):
@@ -158,9 +206,22 @@ def gene_finder(dna):
         dna: a DNA sequence
         returns: a list of all amino acid sequences coded by the sequence dna.
     """
-    # TODO: implement this
-    pass
+    threshold = longest_ORF_noncoding(dna, 1500) # sets the treshold
+    open_reading_frames = find_all_ORFs_both_strands(dna) # find all open reading frames on both strands
+    i = 0
+    aa_sequence = []
+    for i in range(len(open_reading_frames)):
+        if len(open_reading_frames[i]) > threshold:
+            aminos = coding_strand_to_AA(open_reading_frames[i]) #return the amino_acids
+            aa_sequence.append(aminos) #add it to the list
+        i += 1
+    return aa_sequence ## return the list containing the amino acid sequence encoded longer than treshold
 
 if __name__ == "__main__":
     import doctest
-    doctest.testmod()
+    # Importing dna
+    from load import load_seq
+    dna = load_seq("./data/X73525.fa")
+    print(gene_finder(dna)) #execute function
+    # doctest.testmod(verbose=True)
+    #doctest.run_docstring_examples(find_all_ORFs, globals(), verbose=True)