-
Notifications
You must be signed in to change notification settings - Fork 0
Folding of RNA pseudoknots in O(n^4) time
License
jensreeder/pknotsRG
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
-------- pknotsRG ------- Folding canonical RNA secondary structures including pseudoknots ---------------------------------------------------------------- Robert Giegerich ([email protected]) Jens Reeder ([email protected]) Practical Computer Science Faculty of Technology University of Bielefeld ---------------------------------------------------------------- pknotsRG is a tool for thermodynamic folding of RNA secondary structures, including the class of canonical simple recursive pseudoknots. This class and the algorithms are described in detail in: "Design, Implementation and Evaluation of a Practical Pseudoknot Folding Algorithm based on Thermodynamics", Jens Reeder and Robert Giegerich, BMC Bioinformatics 2004. ---------------------------------------------------------------- Files: Algebras.lhs Energy.lhs Foldingspace.lhs RNACombinators.lhs Intloop.lhs Intloop21.lhs Intloop22.lhs pknotsRG-mfe.lhs pknotsRG-enf.lhs pknotsRG-loc.lhs ADPfold.lhs (an RNAfold clone using ADP) Building: We compile the files with ghc using make (see makefile for details). First try make If this doesn't work, you have to run ghc by yourself: ghc --make -O2 pknotsRG-mfe.lhs ---------------------------------------------------------------- Currently there are three different version available: pknotsRG-mfe: computes the best structure (i.e. the structure with minimum free energy). pknotsRG-enf: computes the best structure that actually contains at least one pseudoknot. pknotsRG-loc: computes the best "compact" pseudoknot, i.e. the structure with the lowest energy to length ratio. Usage: pknotsRG-mfe ucaaguauuccgaagcucaacgggaaaaugagcua or pknotsRG-mfe AUCUGUCAUCUAUUGCUAUCU For the other variants substitute mfe with enf or loc. Optional the size of the pseudoknot can be restricted. This accelerates the computation substantially. We used this parameter to search for pseudoknots of maxsize 100 within sequences of length 1000. pknotsRG-mfe sequence optional_maxsize Note: All non ACGTU characters are internally mapped to N and are disallowed in any basepairings. Output: The output consist of the input sequence, the secondary structure, ad the minimum free energy. Basepairs of the first pseudoknot helix are denoted by '{' and '}', the second helix by '[' and ']' . Basepairs not involved in a pseudoknot correspond to normal brackets, '(' and ')'. Example: UCAAGUAUUCCGAAGCUCAACGGGAAAAUGAGCUA .......[[[[[.{{{{{{.]]]]]...}}}}}}. ( -14.9) Since pknotsRG-loc finds the best local pseudoknot, the output of this variant contains also the start and end position of the corresponding subsequence 7........................34 UUCCGAAGCUCAACGGGAAAAUGAGCU [[[[[.{{{{{{.]]]]]...}}}}}} (-14.51) ----------------------------------------------------------------- The energy model we use for pseudoknots: Destabilizing: creating a new pseudoknot : 9.0 basepair inside pseudoknot: 0.0 not paired base in pk : 0.3 Stabilizing: stacking of basepairs : stack base dangling of a pk pair: dangle coaxial stacking : stack all values in (kcal/mol) stack and dangle are the energies for nested structures like in mfold-3.1. If any nested or unnested structures occur inside a pseudoknot, their energy, of course, contributes to the overall pseudoknot energy.
About
Folding of RNA pseudoknots in O(n^4) time
Resources
License
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published