-
Notifications
You must be signed in to change notification settings - Fork 2
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
13 changed files
with
324 additions
and
61 deletions.
There are no files selected for viewing
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,92 @@ | ||
#include <iostream> | ||
#include <string> | ||
#include <sstream> | ||
#include <vector> | ||
#include <set> | ||
#include <map> | ||
#include <list> | ||
#include <queue> | ||
#include <stack> | ||
#include <memory> | ||
#include <iomanip> | ||
#include <numeric> | ||
#include <functional> | ||
#include <new> | ||
#include <algorithm> | ||
#include <cmath> | ||
#include <cstring> | ||
#include <cstdlib> | ||
#include <cstdio> | ||
#include <climits> | ||
#include <cctype> | ||
#include <ctime> | ||
|
||
#define REP(i, n) for(int (i) = 0; i < n; i++) | ||
#define FOR(i, a, n) for(int (i) = a; i < n; i++) | ||
#define FORR(i, a, n) for(int (i) = a; i <= n; i++) | ||
#define for_each(q, s) for(typeof(s.begin()) q=s.begin(); q!=s.end(); q++) | ||
#define sz(n) n.size() | ||
#define pb(n) push_back(n) | ||
#define all(n) n.begin(), n.end() | ||
|
||
template<typename T> T gcd(T a, T b) { | ||
if(!b) return a; | ||
return gcd(b, a % b); | ||
} | ||
template<typename T> T lcm(T a, T b) { | ||
return a * b / gcd(a, b); | ||
} | ||
|
||
template<typename T> void chmin(T& a, T b) { a = (a > b) ? b : a; } | ||
template<typename T> void chmax(T& a, T b) { a = (a < b) ? b : a; } | ||
int in() { int x; scanf("%d", &x); return x; } | ||
|
||
using namespace std; | ||
|
||
typedef long long Int; | ||
typedef unsigned uint; | ||
typedef unsigned long long uInt; | ||
|
||
const uInt MOD = 100000000007; | ||
const int MAXN = 10007; | ||
|
||
int T; | ||
int N, N_N; | ||
|
||
char str[MAXN]; | ||
|
||
int main(void) { | ||
T = in(); | ||
|
||
int i, j, k; | ||
|
||
for ( ; T--; ) { | ||
N = in(); | ||
|
||
map<uInt, int> mp; | ||
int ans = 0; | ||
|
||
for (i = 0; i < N; i++) { | ||
scanf("%s", str); N_N = strlen(str); | ||
|
||
map<uInt, int> buff; | ||
|
||
for (j = 0; j < N_N; j++) { | ||
uInt hash = 1ULL; | ||
for (k = j; k < N_N; k++) { | ||
hash = (((hash * 131ULL) * (str[k] - 'A' + 1)) % MOD) + 1; | ||
|
||
if (buff[hash] == 1) continue; | ||
|
||
buff[hash] = 1; mp[hash] += 1; | ||
|
||
if (mp[hash] == N && ans < k - j + 1) { | ||
ans = k - j + 1; | ||
} | ||
} | ||
} | ||
} | ||
printf("%d\n", ans); | ||
} | ||
return 0; | ||
} |
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,3 +1,9 @@ | ||
1 2 2 4 0 | ||
1 2 3 4 1 2 3 3 4 2 0 | ||
0 | ||
2 | ||
2 | ||
ACGGGCGTCGTCCCCGTCGTCGTATC | ||
CTCGTCGTCCCCGTCGTCGTGTC | ||
3 | ||
ACGACGGCTGCGGTAACCC | ||
TTACGGCTGCGGTCCCCTT | ||
CCCCCCGTTTACGGCTGCGGTGG | ||
|
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,90 @@ | ||
#include <iostream> | ||
#include <string> | ||
#include <sstream> | ||
#include <vector> | ||
#include <set> | ||
#include <map> | ||
#include <list> | ||
#include <queue> | ||
#include <stack> | ||
#include <memory> | ||
#include <iomanip> | ||
#include <numeric> | ||
#include <functional> | ||
#include <new> | ||
#include <algorithm> | ||
#include <cmath> | ||
#include <cstring> | ||
#include <cstdlib> | ||
#include <cstdio> | ||
#include <climits> | ||
#include <cctype> | ||
#include <ctime> | ||
|
||
#define REP(i, n) for(int (i) = 0; i < n; i++) | ||
#define FOR(i, a, n) for(int (i) = a; i < n; i++) | ||
#define FORR(i, a, n) for(int (i) = a; i <= n; i++) | ||
#define for_each(q, s) for(typeof(s.begin()) q=s.begin(); q!=s.end(); q++) | ||
#define sz(n) n.size() | ||
#define pb(n) push_back(n) | ||
#define all(n) n.begin(), n.end() | ||
|
||
template<typename T> T gcd(T a, T b) { | ||
if(!b) return a; | ||
return gcd(b, a % b); | ||
} | ||
template<typename T> T lcm(T a, T b) { | ||
return a * b / gcd(a, b); | ||
} | ||
|
||
template<typename T> void chmin(T& a, T b) { a = (a > b) ? b : a; } | ||
template<typename T> void chmax(T& a, T b) { a = (a < b) ? b : a; } | ||
int in() { int x; scanf("%d", &x); return x; } | ||
|
||
using namespace std; | ||
|
||
typedef long long Int; | ||
typedef unsigned uint; | ||
typedef unsigned long long uInt; | ||
|
||
const uInt MOD = 1000000009; | ||
const int MAXN = 10007; | ||
|
||
int T; | ||
int N, N_N; | ||
|
||
char str[MAXN]; | ||
|
||
int main(void) { | ||
freopen("i.in", "r", stdin); | ||
T = in(); | ||
|
||
int i, j, k; | ||
|
||
for ( ; T--; ) { | ||
N = in(); | ||
|
||
map<uInt, int> mp; | ||
int ans_cnt = 0, ans_len; | ||
|
||
for (i = 0; i < N; i++) { | ||
scanf("%s", str); N_N = strlen(str); | ||
|
||
for (j = 0; j < N_N; j++) { | ||
uInt hash = 0LL; | ||
for (k = j; k < N_N; k++) { | ||
hash = ((hash * 31) ^ (str[k] - 'A')) % MOD; | ||
mp[hash] += 1; | ||
|
||
if (mp[hash] > ans_cnt) { | ||
ans_cnt = mp[hash], ans_len = k - j + 1; | ||
} | ||
} | ||
} | ||
} | ||
|
||
printf("%d\n", ans_len); | ||
|
||
} | ||
return 0; | ||
} |
Binary file not shown.
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,58 +1,41 @@ | ||
#include <stdio.h> | ||
|
||
int main(){ | ||
int width, height, slotVazios, x1, x2, y1, y2, xMenor, xMaior, yMenor, yMaior, subpartes, i,j, k, board[550][550]; | ||
scanf( "%i%i%i", &width, &height, &subpartes ); | ||
while( height != 0 ){ | ||
slotVazios = width * height; | ||
for( i = 0; i < width; i++) { | ||
for( j = 0; j < height; j++) { | ||
board[i][j] = 0; | ||
} | ||
} | ||
for(i = 0; i < subpartes; i++) { | ||
scanf( "%i%i%i%i", &x1, &y1, &x2, &y2); | ||
if( x1 <= x2 ){ | ||
xMenor = x1; | ||
xMaior = x2; | ||
} | ||
else{ | ||
xMenor = x2; | ||
xMaior = x1; | ||
} | ||
if( y1 <= y2 ){ | ||
yMenor = y1; | ||
yMaior = y2; | ||
} | ||
else{ | ||
yMenor = y2; | ||
yMaior = y1; | ||
} | ||
for(j = xMenor; j<= xMaior; j++ ){ | ||
for( k = yMenor; k <= yMaior; k++ ){ | ||
if( board[j-1][k-1] == 0 ){ | ||
board[j-1][k-1] = 1; | ||
slotVazios--; | ||
} | ||
} | ||
} | ||
} | ||
|
||
switch( slotVazios ){ | ||
case 0: | ||
printf( "There is no empty spots.\n" ); | ||
break; | ||
case 1: | ||
printf( "There is one empty spot.\n" ); | ||
break; | ||
default: | ||
printf( "There are %i empty spots.\n", slotVazios ); | ||
break; | ||
} | ||
|
||
scanf( "%i%i%i", &width, &height, &subpartes ); | ||
} | ||
|
||
|
||
return 0; | ||
} | ||
#include <stdio.h> | ||
#include <algorithm> | ||
|
||
using namespace std; | ||
|
||
int N, M, P; | ||
int slot, x1, x2, y1, y2; | ||
int subpartes, i,j, k, board[550][550]; | ||
|
||
int main(void) { | ||
for ( ; scanf("%d%d%d", &N, &M, &P) == 3; ) { | ||
slot = N * M; | ||
for (i = 0; i < N; i++) { | ||
for(j = 0; j < M; j++) { | ||
board[i][j] = 0; | ||
} | ||
} | ||
|
||
for (i = 0; i < P; i++) { | ||
int d = scanf("%d%d%d%d", &x1, &y1, &x2, &y2); | ||
|
||
for (j = min(x1, x2); j <= max(x1, x2); j++) { | ||
for (k = min(y1, y2); k <= max(y1, y2); k++) { | ||
if (board[j-1][k-1] == 0) { | ||
board[j-1][k-1] = 1; | ||
slot--; | ||
} | ||
} | ||
} | ||
} | ||
|
||
if (slot == 0) { | ||
printf("There is no empty spots.\n"); | ||
} else if (slot == 1) { | ||
printf("There is one empty spot.\n"); | ||
} else { | ||
printf("There are %d empty spots.\n", slot); | ||
} | ||
} | ||
return 0; | ||
} |
Binary file not shown.
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,92 @@ | ||
#include <iostream> | ||
#include <string> | ||
#include <sstream> | ||
#include <vector> | ||
#include <set> | ||
#include <map> | ||
#include <list> | ||
#include <queue> | ||
#include <stack> | ||
#include <memory> | ||
#include <iomanip> | ||
#include <numeric> | ||
#include <functional> | ||
#include <new> | ||
#include <algorithm> | ||
#include <cmath> | ||
#include <cstring> | ||
#include <cstdlib> | ||
#include <cstdio> | ||
#include <climits> | ||
#include <cctype> | ||
#include <ctime> | ||
|
||
#define REP(i, n) for(int (i) = 0; i < n; i++) | ||
#define FOR(i, a, n) for(int (i) = a; i < n; i++) | ||
#define FORR(i, a, n) for(int (i) = a; i <= n; i++) | ||
#define for_each(q, s) for(typeof(s.begin()) q=s.begin(); q!=s.end(); q++) | ||
#define sz(n) n.size() | ||
#define pb(n) push_back(n) | ||
#define all(n) n.begin(), n.end() | ||
|
||
template<typename T> T gcd(T a, T b) { | ||
if(!b) return a; | ||
return gcd(b, a % b); | ||
} | ||
template<typename T> T lcm(T a, T b) { | ||
return a * b / gcd(a, b); | ||
} | ||
|
||
template<typename T> void chmin(T& a, T b) { a = (a > b) ? b : a; } | ||
template<typename T> void chmax(T& a, T b) { a = (a < b) ? b : a; } | ||
int in() { int x; scanf("%d", &x); return x; } | ||
|
||
using namespace std; | ||
|
||
typedef long long Int; | ||
typedef unsigned uint; | ||
|
||
struct Node { | ||
int used; | ||
|
||
Node* child[30]; | ||
|
||
Node() { | ||
this->used = 0; | ||
} | ||
|
||
void add(string str, int pos, int len) { | ||
if (pos == len) return; | ||
|
||
int curr = str[pos] - 'A'; | ||
|
||
Node *next = child[curr]; | ||
|
||
if (null == NULL) next = new Node(); | ||
|
||
|
||
} | ||
}; | ||
|
||
struct SuffixTree { | ||
int words; | ||
|
||
Node root; | ||
|
||
void addSuffix(string str) { | ||
string base; | ||
|
||
int i; | ||
|
||
for (i = (int) str.size() - 1; i >= 0; i--) { | ||
base += str[i]; | ||
|
||
root.add(base, 0, (int) str.size()); | ||
} | ||
} | ||
}; | ||
|
||
int main(void) { | ||
|
||
return 0; | ||
} |
Binary file not shown.