diff --git a/build.rs b/build.rs index ae86ef9..d1db2c4 100644 --- a/build.rs +++ b/build.rs @@ -21,7 +21,6 @@ fn libcxx() -> &'static str { } fn main() { - cc::Build::new() .cpp(true) .static_flag(true) diff --git a/src/lib.rs b/src/lib.rs index 8bd3e75..1b1e5b3 100644 --- a/src/lib.rs +++ b/src/lib.rs @@ -178,6 +178,12 @@ pub struct StarAligner { unsafe impl Send for StarAligner {} +/// A container for the primary and secondary alignments +pub struct StarAlignment { + pub primary: bam::Record, + pub secondary: Vec, +} + impl StarAligner { fn new(reference: Arc) -> StarAligner { let aligner = unsafe { bindings::init_aligner_from_ref(reference.as_ref().reference) }; @@ -190,7 +196,7 @@ impl StarAligner { } /// Aligns a given read and produces BAM records - pub fn align_read(&mut self, name: &[u8], read: &[u8], qual: &[u8]) -> Vec { + pub fn align_read(&mut self, name: &[u8], read: &[u8], qual: &[u8]) -> StarAlignment { align_read_rust(self.aligner, read, qual, &mut self.aln_buf).unwrap(); self.parse_sam_to_records(name) } @@ -209,21 +215,50 @@ impl StarAligner { qual1: &[u8], read2: &[u8], qual2: &[u8], - ) -> (Vec, Vec) { + ) -> (StarAlignment, StarAlignment) { align_read_pair_rust(self.aligner, read1, qual1, read2, qual2, &mut self.aln_buf).unwrap(); - let full_vec = self.parse_sam_to_records(name); - - // Partition the records into first mate and second mate - let mut first_vec: Vec = Vec::new(); - let mut second_vec: Vec = Vec::new(); - for rec in full_vec { - if rec.is_first_in_template() { - first_vec.push(rec); - } else { - second_vec.push(rec); + + let mut primary1: Option = None; + let mut primary2: Option = None; + let mut secondary1 = Vec::new(); + let mut secondary2 = Vec::new(); + + for slc in self.aln_buf.split(|c| *c == b'\n') { + if slc.len() > 0 { + self.sam_buf.clear(); + self.sam_buf.extend_from_slice(name); + self.sam_buf.extend_from_slice(slc); + let record = + bam::Record::from_sam(&self.reference.as_ref().header_view, &self.sam_buf) + .unwrap(); + let is_primary = !record.is_secondary(); + let is_first = record.is_first_in_template(); + if is_primary && is_first && primary1.is_none() { + let _ = primary1.replace(record); + } else if is_primary && !is_first && primary2.is_none() { + let _ = primary2.replace(record); + } else if is_first { + secondary1.push(record); + } else { + secondary2.push(record); + } } } - (first_vec, second_vec) + + // if we don't have primary alignments, panic + let primary1 = primary1.unwrap(); + let primary2 = primary2.unwrap(); + + ( + StarAlignment { + primary: primary1, + secondary: secondary1, + }, + StarAlignment { + primary: primary2, + secondary: secondary2, + }, + ) } /// Aligns a given read and return the resulting SAM string @@ -242,8 +277,9 @@ impl StarAligner { /// Given a list of BAM records as a SAM-format string in which records are separated by new /// lines, add the records to a vector and append the read name to the beginning of them so /// that they conform with BAM specifications - fn parse_sam_to_records(&mut self, name: &[u8]) -> Vec { - let mut records = Vec::new(); + fn parse_sam_to_records(&mut self, name: &[u8]) -> StarAlignment { + let mut primary: Option = None; + let mut secondary = Vec::new(); for slc in self.aln_buf.split(|c| *c == b'\n') { if slc.len() > 0 { self.sam_buf.clear(); @@ -252,11 +288,18 @@ impl StarAligner { let record = bam::Record::from_sam(&self.reference.as_ref().header_view, &self.sam_buf) .unwrap(); - records.push(record); + if primary.is_none() && !record.is_secondary() { + let _ = primary.replace(record); + } else { + secondary.push(record); + } } } - records + // if we're missing a primary alignment, panic + let primary = primary.unwrap(); + + StarAlignment { primary, secondary } } } @@ -403,29 +446,32 @@ mod test { let reference = StarReference::load(settings).unwrap(); let mut aligner = reference.get_aligner(); - let recs = aligner.align_read(NAME, ERCC_READ_1, ERCC_QUAL_1); - assert_eq!(recs.len(), 1); - assert_eq!(recs[0].pos(), 50); - assert_eq!(recs[0].tid(), 0); - println!("{:?}", recs); - - let recs = aligner.align_read(NAME, ERCC_READ_2, ERCC_QUAL_2); - assert_eq!(recs.len(), 1); - assert_eq!(recs[0].tid(), 0); - assert_eq!(recs[0].pos(), 500); - println!("{:?}", recs); - - let recs = aligner.align_read(NAME, ERCC_READ_3, ERCC_QUAL_3); - assert_eq!(recs.len(), 2); - assert_eq!(recs[0].flags(), 0); - assert_eq!(recs[0].tid(), 39); - assert_eq!(recs[0].pos(), 27); - assert_eq!(recs[0].mapq(), 3); - assert_eq!(recs[1].flags(), 0x110); // REVERSE,SECONDARY - assert_eq!(recs[1].tid(), 72); - assert_eq!(recs[1].pos(), 553); - assert_eq!(recs[1].mapq(), 3); - println!("{:?}", recs); + let StarAlignment { primary, secondary } = + aligner.align_read(NAME, ERCC_READ_1, ERCC_QUAL_1); + assert_eq!(secondary.len(), 0); + assert_eq!(primary.pos(), 50); + assert_eq!(primary.tid(), 0); + println!("{:?}", primary); + + let StarAlignment { primary, secondary } = + aligner.align_read(NAME, ERCC_READ_2, ERCC_QUAL_2); + assert_eq!(secondary.len(), 0); + assert_eq!(primary.tid(), 0); + assert_eq!(primary.pos(), 500); + println!("{:?}", primary); + + let StarAlignment { primary, secondary } = + aligner.align_read(NAME, ERCC_READ_3, ERCC_QUAL_3); + assert_eq!(secondary.len(), 1); + assert_eq!(primary.flags(), 0); + assert_eq!(primary.tid(), 39); + assert_eq!(primary.pos(), 27); + assert_eq!(primary.mapq(), 3); + assert_eq!(secondary[0].flags(), 0x110); // REVERSE,SECONDARY + assert_eq!(secondary[0].tid(), 72); + assert_eq!(secondary[0].pos(), 553); + assert_eq!(secondary[0].mapq(), 3); + println!("{:?}, {:?}", primary, secondary); } #[test] @@ -437,19 +483,21 @@ mod test { let t1 = std::thread::spawn(move || { for _ in 0..100000 { - let recs = aligner1.align_read(NAME, ERCC_READ_1, ERCC_QUAL_1); - assert_eq!(recs.len(), 1); - assert_eq!(recs[0].pos(), 50); - assert_eq!(recs[0].tid(), 0); + let StarAlignment { primary, secondary } = + aligner1.align_read(NAME, ERCC_READ_1, ERCC_QUAL_1); + assert_eq!(secondary.len(), 0); + assert_eq!(primary.pos(), 50); + assert_eq!(primary.tid(), 0); } }); let t2 = std::thread::spawn(move || { for _ in 0..100000 { - let recs = aligner2.align_read(NAME, ERCC_READ_2, ERCC_QUAL_2); - assert_eq!(recs.len(), 1); - assert_eq!(recs[0].pos(), 500); - assert_eq!(recs[0].tid(), 0); + let StarAlignment { primary, secondary } = + aligner2.align_read(NAME, ERCC_READ_2, ERCC_QUAL_2); + assert_eq!(secondary.len(), 0); + assert_eq!(primary.pos(), 500); + assert_eq!(primary.tid(), 0); } }); @@ -510,9 +558,9 @@ mod test { let read = b"GTGCGGGGAGAAGTTTCAAGAAGGTTCTTATGGAAAAAAGGCTGTGAGCATAGAAAGCAGTCATAGGAGGTTGGGGAACTAGCTTGTCCCTCCCCACC"; let qual = b"GGGAGIGIIIGIIGGGGIIGGIGGAGGAGGAAG.GGIIIG 0); - assert_eq!(res[0].pos(), 30070473); + let StarAlignment { primary, secondary } = aligner.align_read(name, read, qual); + assert_eq!(secondary.len(), 0); + assert_eq!(primary.pos(), 30070473); } #[test] @@ -528,9 +576,10 @@ mod test { let read = b"GTGCGGGGAGAAGTTTCAAGAAGGTTCTTATGGAAAAAAGGCTGTGAGCATAGAAAGCAGTCATAGGAGGTTGGGGAACTAGCTTGTCCCTCCCCACC"; let qual = b"GGGAGIGIIIGIIGGGGIIGGIGGAGGAGGAAG.GGIIIG